Sıra | DOSYA ADI | Format | Bağlantı |
---|---|---|---|
01. | Journal Journals Multiple Release | pptx | Sunumu İndir |
Transkript
Programmable Materials for Drug Delivery and Regenerative MedicineYong Wang Department of Biomedical Engineering Pennsylvania State University, University Park, PA 16802
Goal: To develop biomolecular and biomimetic materials whose multiple functions can be programmed in diverse ways. GT5’3’ACTCAATCTGC CGTTGACGGTTAGACCCGGGGTCA AAAAFrom affinity aptamerssupportingcellTo tissue-likebiomaterialsTo intelligentnanobiomaterialsXXXXXXXXXXX X XX XXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXX
J. R. Soc. Interface (2011) 8, 153–170On-Demand Release of Multiple Protein Drugs For Tissue Engineering and Regenerative Medicine? Sequence? Dose? Time? Duration
Principle: Molecular RecognitionSoontornworajit, B. , Zhou, J. , Snipes, M., Battig, M., Wang, Y. Biomaterials. 2011, 32: 6839-6849.+: aptamer : targetSoontornworajit B, Zhou J, Shaw MT, Fan, TS, Wang Y. Chemical Communications 2010; 46:1857-1859
Nucleic Acid Aptamers Single-stranded oligonucleotides screened from the library of synthetic oligonucleotidesIncubatePartitionAmplifyRepeattargetLibrary1012 ~ 1014•Tuerk C, and Gold L (1990) Science 249: 505-510•Ellington AD, and Szostak JW (1990) Nature 346: 818-822
Nucleic Acid Aptamers High specificity High affinity Little immunogenicity Small size Easy synthesis Tolerant of harsh chemical/physical conditions High resistance against nuclease degradation Controllable reversibility in molecular recognition(2009) Structure 17: 1476-1484
Soontornworajit B, Zhou J, Shaw MT, Fan, TS, Wang Y. Chemical Communications 2010; 46:1857-1859Synthesis of Aptamer-Functionalized Hydrogels via Free Radical PolymerizationAPS/TEMED
w/o aptamersw/ aptamersRetention/Release of Growth FactorsSoontornworajit B, Zhou J, Shaw MT, Fan, TS, Wang Y. Chemical Communications 2010; 46:1857-1859
Effect of Binding Affinity on Retention/Release of Growth FactorsSoontornworajit B, Zhou J, Shaw MT, Fan, TS, Wang Y. Chemical Communications 2010; 46:1857-1859
Good: • Aptamers were able to retain growth factors in the hydrogels;• The retention/release could be modulated by varying the binding affinity of the aptamer.Bad: • Some growth factors were significantly or completely denatured during the synthesis of hydrogels. • We also tried other methods like photoinitiated polymerization. It did not work well for us. Pros & Cons
+aptamer Battig, M.R., Soontornworajit, B. Wang, Y.* Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization. Journal of the American Chemical Society. 2012, 134, 12410-12413Synthesis of Aptamer-Functionalized HydrogelsUsing Thermoresponsive Solutions
Battig, M.R., Soontornworajit, B. Wang, Y.* Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization. Journal of the American Chemical Society. 2012, 134, 12410-12413Release of Growth Factors from Aptamer-Functionalized Agarose Hydrogels
RetentionSoontornworajit, B. , Zhou, J. , Snipes, M., Battig, M., Wang, Y. Biomaterials. 2011, 32: 6839-6849.++ +Battig, M.R., Soontornworajit, B. Wang, Y.. Journal of the American Chemical Society. 2012, 134, 12410-12413.Programmable Release
Region for Hybridization
-102050800 200 400 600Response (mRIU)Time (s)PBS CO-4 CO-5 CO-6Association Dissociation Apt-1: 5’- ACAGGCTACGGCACGTAGAGCATCACCATGATCCTG -3’CO-6: 3’- TGTCCGATGCCGTGCATCTCGTAGTGGTACTAGGAC -5’CO-5: 3’- CGTGCATCTCGTAGTGGTACTAGGAC -5’CO-4: 3’- GTAGTGGTACTAGGAC -5’Length of Hybridization
Synergistic Effect: Tail + Length 3’-ACACTGAACTCGTTTTA-5’ 3’-GGACACTGAACTCGTTTTA-5’
association dissociationw/o triggerw/ triggerSPR Analysis of Programmable Molecular Recognitionaptamer
Controlled Protein Release via Intermolecular HybridizationProgrammable Release of Multiple Protein DrugsTwo different protein drugs were programmed to release at days 5 and 10.Battig, M.R., Soontornworajit, B. Wang, Y.* Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization. Journal of the American Chemical Society. 2012, 134, 12410-12413
Nonporous w/o aptamerw/ aptamer0-910-1920-2930-3940-4950-5960-6970-7980-8990-990102030Pore size [µm]%Structures of Superporous Hydrogels0°+40°xyxyz
Controlled Protein Release via Intermolecular HybridizationHydrogels for the Delivery of Protein Drugs - Past & Current Nature; 1976 (263): 797-800 Experimental & Molecular Medicine 2012 (44), 350-355PastCurrentBiomaterials2014; 35(27), 8040-8048
OMICS Internationalwww.omicsonline.orgContact us at: contact.omics@omicsonline.orgOMICS International (and its subsidiaries), is an Open Access publisher and international conference Organizer, which owns and operates peer-reviewed Clinical, Medical, Life Sciences, and Engineering & Technology journals and hosts scholarly conferences per year in the fields of clinical, medical, pharmaceutical, life sciences, business, engineering, and technology. Our journals have more than 3 million readers and our conferences bring together internationally renowned speakers and scientists to create exciting and memorable events, filled with lively interactive sessions and world-class exhibitions and poster presentations. Join us!OMICS International is always open to constructive feedback. We pride ourselves on our commitment to serving the Open Access community and are always hard at work to become better at what we do. We invite your concerns, questions, even complaints. Contact us at contact.omics@omicsonline.org. We will get back to you in 24-48 hours. You may also call 1-800-216-6499 (USA Toll Free) or at +1-650-268-9744 and we will return your call in the same timeframe.I I ti l ( it i i i ), i li i t ti l f i , i t - i li i l, i l, if i , i i l j r l t l rl f r r r i t fi l f li i l, i l, ti l, lif i , i , i i , t l . j l t illi f i t t i t ti ll i ti t t t iti l t , fill it li l i t ti i l - l i iti t t ti . J i !I I t ti l i l t t ti f . i l it t t i t it l t t tt t t . i it r r , ti , l i t . t t t t t. i i li . r . ill t t i - . l ll - - - ( ll ) t - - - ill t ll i t ti f .
Journal of Tissue Science & EngineeringRelated Journals Journal of Biochips & Tissue Chips Journal of Stem Cell Research & Therapy Journal of Biomimetics Biomaterials and Tissue Engineeringl i i i
http://www.conferenceseries.com/Journal of Tissue Science & Engineering Related Conferences
OMICS Group Open Access MembershipOMICS publishing Group Open Access Membership enables academic and research institutions, funders and corporations to actively encourage open access in scholarly communication and the dissemination of research published by their authors.For more details and benefits, click on the link below:http://omicsonline.org/membership.php